Sign In
or
Sign Up
Welcome, Guest
NEB_Logo_Australia Logo Logo NEB_Logo_Australia
  • Applications & Products Applications & Products
    • Applications

    • COVID-19 Research
    • Cloning & Synthetic Biology
    • DNA Amplification, PCR and qPCR
    • Genome Editing
    • RNA Analysis
    • Sample Prep for NGS & Target Enrichment
    • Epigenetics
    • Protein Expression
    • Protein Purification
    • Protein Analysis & Tools
    • Glycobiology & Proteomics
    • Cellular Analysis
    • Categories

    • Restriction Endonucleases
    • PCR, qPCR & Amplification Technologies
    • DNA Modifying Enzymes
    • Sample Prep for NGS & Target Enrichment
    • Nucleic Acid Purification
    • Markers & Ladders
    • RNA Reagents
    • DNA Assembly Cloning and Mutagenesis Kits
    • Genome Editing
    • Cellular Analysis
    • Epigenetics
    • Protein Expression & Purification Technologies
    • Competent Cells
    • Protein Tools
    • Glycobiology
    • DNA Plasmids & Substrates
    • Buffers
    • Strains
    • Discontinued
    newNew Products
    newSamples & Special Offers
    COVID19_Megamenu_Icon_smallSupporting COVID-19 Research

    Are you doing COVID-19 related research? Our latest RUO kit, the Luna® SARS-CoV-2 RT-qPCR Multiplex Assay Kit, enables high throughput workflows for real-time detection of SARS-CoV-2 nucleic acid using hydrolysis probes. For simple, visual assay results, the SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit includes a color-changing pH indicator for detection of SARS-CoV-2 nucleic acid amplification

    Learn about our tools that are helping researchers develop diagnostics and vaccines for the SARS-CoV-2 virus.

    Time for Change

    Monarch Nucleic Acid Purification Kits are optimized for maximum performance and minimal environmental impact. Kits are available for total RNA purification, plasmid miniprep, gel extraction, and DNA & RNA cleanup. For maximum convenience and value, columns and buffers are also available separately. Learn more and request a sample!

  • Tools & Resources Tools & Resources
    • Tools

    • Product Selection
    • Restriction Enzyme Tools
    • Primer Design Tools
    • Experimental Design
    • Calculators
    • Databases
    • Additional Tools
    • Resources

    • FAQs
    • Protocols
    • Selection Charts
    • Troubleshooting Guides
    • Usage Guidelines/Tips
    • Interactive Tools
    • Video Library
    • Web Tools
    • Webinars
    • Application Notes
    blog_megamenu_36x36NEBinspired Blog
    MonarchMatchGame_iconMonarch Memory Game
    catalogOrder Catalog
  • Support Support
    • Customer Feedback
    • Technical Support
    • International Ordering & Support
    • Catalog & Request Literature
    • OEM & Customized Solutions
    • Biotech Support
    • Packaging & Shipping
    • Terms Of Sale
    icon-cta-feedbackCustomer Suggestions & Feedback

    Contact Information

    22/270 Ferntree Gully Road
    Notting Hill VIC 3168
    1800 934 218
    [email protected]
  • About About
    • NEB Overview
    • News & Press Releases
    • Leadership
    • Research at NEB
    • Environmental Commitment
    • Social Responsibility & Sustainability
    • Quality at NEB
    • ISO Certification
    • Passion in Science Award
    • Business Development Opportunities
    • Careers
    • Contact Us

    Contact Information

    22/270 Ferntree Gully Road
    Notting Hill VIC 3168
    1800 934 218
    [email protected]
  • Quick Order
Search
Quick Order
| |
  • Sign In
  • Sign Up
Home FAQs What sequences need to be trimmed for NEBNext libraries that are sequenced on an Illumina instrument?

FAQ: What sequences need to be trimmed for NEBNext libraries that are sequenced on an Illumina instrument?

The NEBNext libraries for Illumina resemble TruSeq libraries and can be trimmed like TruSeq:

Adaptor Read1   AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Adaptor Read2   AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT   

Links to this resource

Related Products:
NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1),
NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 2),
NEBNext Multiplex Oligos for Illumina (Index Primers Set 3),
NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 4), NEBNext® Multiplex Oligos for Illumina® (96 Index Primers), NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1), NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 2), NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs), NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs Set 2), NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs Set 3), NEBNext® Multiplex Oligos for Illumina® (96 x 96 Unique, Matched Dual Index Primers Set 4),

NEBNext® Multiplex Oligos for Enzymatic Methyl-seq Unique Dual Index Primer Pairs

,
NEBNext® Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors DNA Set 1), NEBNext® Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors RNA Set 1)

To Request Technical Support

Fill out our Technical Support Form,
email us, or call 1800 934 218.

For Customers Outside of Australia

Contact your local subsidiary or distributor. 

For Help With Your Order

Contact our Customer Service Team by
email or call 1800 934 218.

Sign up and select NEB email newsletters targeted to your research

Support NEB Overview Contact Us Careers Site Map Terms of Use Trademarks Terms of Sale Privacy USA  US Site
© Copyright 2021 New England Biolabs. All Rights Reserved.

Choose your country

North America

Canada CANADA USA UNITED STATES

Europe

Austria AUSTRIA France FRANCE Germany GERMANY UK UNITED KINGDOM

Pacific Asia

Australia AUSTRALIA China CHINA Japan JAPAN NewZealand NEW ZEALAND Singapore SINGAPORE
Loading Spinner

Session Expired

You have been idle for more than 20 minutes, for your security you have been logged out. Please sign back in to continue your session.

Institution Changed

Your profile has been mapped to an Institution, please sign back for your profile updates to be completed.

Sign in to your NEB account

To save your cart and view previous orders, sign in to your NEB account. Adding products to your cart without being signed in will result in a loss of your cart when you do sign in or leave the site.

Sign In